Review





Similar Products

wild type p gingivalis atcc 33277 fima intact  (ATCC)
99
ATCC wild type p gingivalis atcc 33277 fima intact
Wild Type P Gingivalis Atcc 33277 Fima Intact, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/wild type p gingivalis atcc 33277 fima intact/product/ATCC
Average 99 stars, based on 1 article reviews
wild type p gingivalis atcc 33277 fima intact - by Bioz Stars, 2026-04
99/100 stars
  Buy from Supplier
p gulae atcc 51700 fima type  (ATCC)
94
ATCC p gulae atcc 51700 fima type
P Gulae Atcc 51700 Fima Type, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/p gulae atcc 51700 fima type/product/ATCC
Average 94 stars, based on 1 article reviews
p gulae atcc 51700 fima type - by Bioz Stars, 2026-04
94/100 stars
  Buy from Supplier
fima ii  (ATCC)
97
ATCC fima ii
Fima Ii, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/fima ii/product/ATCC
Average 97 stars, based on 1 article reviews
fima ii - by Bioz Stars, 2026-04
97/100 stars
  Buy from Supplier
fima gene  (Amano Inc)
90
Amano Inc fima gene
Fima Gene, supplied by Amano Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/fima gene/product/Amano Inc
Average 90 stars, based on 1 article reviews
fima gene - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier
strains coding type i fima  (Amano Inc)
90
Amano Inc strains coding type i fima
Strains Coding Type I Fima, supplied by Amano Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/strains coding type i fima/product/Amano Inc
Average 90 stars, based on 1 article reviews
strains coding type i fima - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier
polyclonal rabbit antiserum against p. gingivalis w83 fima  (Davids Biotechnologie)
90
Davids Biotechnologie polyclonal rabbit antiserum against p. gingivalis w83 fima
Polyclonal Rabbit Antiserum Against P. Gingivalis W83 Fima, supplied by Davids Biotechnologie, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/polyclonal rabbit antiserum against p. gingivalis w83 fima/product/Davids Biotechnologie
Average 90 stars, based on 1 article reviews
polyclonal rabbit antiserum against p. gingivalis w83 fima - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier
antibody anti- e. coli fima  (Cusabio)
90
Cusabio antibody anti- e. coli fima
( A ) The diagram shows the genes for the FimB and FimE recombinases, the invertible fimS region which contains the promoter for the fim operon, and the fim operon which codes for the proteins of the type 1 pilus. Primer pairs 1–2 and 1–3 detect the fimS region in the phase OFF and ON orientations, respectively. The DNA sizes for phases OFF and ON are 884 and 394, respectively, for wild-type strains of <t>E.</t> <t>coli</t> , such as MG1655. Our lab strain of W3110 has an IS1 element insertion in fimE which increases the size of the amplified DNA fragment. MG1655 was analyzed as a control. Primer 1 is 5’- CCGCGATGCTTTCCTCTATG -3’; primer 2 is 5’- TAATGACGCCCTGAAATTGC -3’; and primer 3 is 5’- TGCTAACTGGAAAGGCGCTG -3’ (shown schematically). ( B ) Deletion of either speB or hns had no effect on fimS orientation. A possible explanation for the loss of pili or PDSM in the speB or hns mutants is locking the fimS switch in phase OFF. However, loss of either speB or hns had no effect on fimS orientation in W3110 (lanes 2–4), and putrescine did not alter fimS orientation of the W3110 ΔspeB mutant (lanes 6 and 7). We conclude that loss of speB in W3110 did not phase-lock fimS in phase OFF. Also note that W3110, which has an insertion in fimE , is not locked in phase ON.
Antibody Anti E. Coli Fima, supplied by Cusabio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/antibody anti- e. coli fima/product/Cusabio
Average 90 stars, based on 1 article reviews
antibody anti- e. coli fima - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier
antibody anti-e. coli fima (rabbit polyclonal)  (Cusabio)
90
Cusabio antibody anti-e. coli fima (rabbit polyclonal)
( A ) The diagram shows the genes for the FimB and FimE recombinases, the invertible fimS region which contains the promoter for the fim operon, and the fim operon which codes for the proteins of the type 1 pilus. Primer pairs 1–2 and 1–3 detect the fimS region in the phase OFF and ON orientations, respectively. The DNA sizes for phases OFF and ON are 884 and 394, respectively, for wild-type strains of <t>E.</t> <t>coli</t> , such as MG1655. Our lab strain of W3110 has an IS1 element insertion in fimE which increases the size of the amplified DNA fragment. MG1655 was analyzed as a control. Primer 1 is 5’- CCGCGATGCTTTCCTCTATG -3’; primer 2 is 5’- TAATGACGCCCTGAAATTGC -3’; and primer 3 is 5’- TGCTAACTGGAAAGGCGCTG -3’ (shown schematically). ( B ) Deletion of either speB or hns had no effect on fimS orientation. A possible explanation for the loss of pili or PDSM in the speB or hns mutants is locking the fimS switch in phase OFF. However, loss of either speB or hns had no effect on fimS orientation in W3110 (lanes 2–4), and putrescine did not alter fimS orientation of the W3110 ΔspeB mutant (lanes 6 and 7). We conclude that loss of speB in W3110 did not phase-lock fimS in phase OFF. Also note that W3110, which has an insertion in fimE , is not locked in phase ON.
Antibody Anti E. Coli Fima (Rabbit Polyclonal), supplied by Cusabio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/antibody anti-e. coli fima (rabbit polyclonal)/product/Cusabio
Average 90 stars, based on 1 article reviews
antibody anti-e. coli fima (rabbit polyclonal) - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

Image Search Results


( A ) The diagram shows the genes for the FimB and FimE recombinases, the invertible fimS region which contains the promoter for the fim operon, and the fim operon which codes for the proteins of the type 1 pilus. Primer pairs 1–2 and 1–3 detect the fimS region in the phase OFF and ON orientations, respectively. The DNA sizes for phases OFF and ON are 884 and 394, respectively, for wild-type strains of E. coli , such as MG1655. Our lab strain of W3110 has an IS1 element insertion in fimE which increases the size of the amplified DNA fragment. MG1655 was analyzed as a control. Primer 1 is 5’- CCGCGATGCTTTCCTCTATG -3’; primer 2 is 5’- TAATGACGCCCTGAAATTGC -3’; and primer 3 is 5’- TGCTAACTGGAAAGGCGCTG -3’ (shown schematically). ( B ) Deletion of either speB or hns had no effect on fimS orientation. A possible explanation for the loss of pili or PDSM in the speB or hns mutants is locking the fimS switch in phase OFF. However, loss of either speB or hns had no effect on fimS orientation in W3110 (lanes 2–4), and putrescine did not alter fimS orientation of the W3110 ΔspeB mutant (lanes 6 and 7). We conclude that loss of speB in W3110 did not phase-lock fimS in phase OFF. Also note that W3110, which has an insertion in fimE , is not locked in phase ON.

Journal: eLife

Article Title: Control of pili synthesis and putrescine homeostasis in Escherichia coli

doi: 10.7554/eLife.102439

Figure Lengend Snippet: ( A ) The diagram shows the genes for the FimB and FimE recombinases, the invertible fimS region which contains the promoter for the fim operon, and the fim operon which codes for the proteins of the type 1 pilus. Primer pairs 1–2 and 1–3 detect the fimS region in the phase OFF and ON orientations, respectively. The DNA sizes for phases OFF and ON are 884 and 394, respectively, for wild-type strains of E. coli , such as MG1655. Our lab strain of W3110 has an IS1 element insertion in fimE which increases the size of the amplified DNA fragment. MG1655 was analyzed as a control. Primer 1 is 5’- CCGCGATGCTTTCCTCTATG -3’; primer 2 is 5’- TAATGACGCCCTGAAATTGC -3’; and primer 3 is 5’- TGCTAACTGGAAAGGCGCTG -3’ (shown schematically). ( B ) Deletion of either speB or hns had no effect on fimS orientation. A possible explanation for the loss of pili or PDSM in the speB or hns mutants is locking the fimS switch in phase OFF. However, loss of either speB or hns had no effect on fimS orientation in W3110 (lanes 2–4), and putrescine did not alter fimS orientation of the W3110 ΔspeB mutant (lanes 6 and 7). We conclude that loss of speB in W3110 did not phase-lock fimS in phase OFF. Also note that W3110, which has an insertion in fimE , is not locked in phase ON.

Article Snippet: Antibody , anti- E. coli FimA (rabbit polyclonal) , Cusabio , Cat #: CSB-PA361210ZA01ENV RRID: AB_3678627 , 1:10,000.

Techniques: Amplification, Control, Mutagenesis

Journal: eLife

Article Title: Control of pili synthesis and putrescine homeostasis in Escherichia coli

doi: 10.7554/eLife.102439

Figure Lengend Snippet:

Article Snippet: Antibody , anti- E. coli FimA (rabbit polyclonal) , Cusabio , Cat #: CSB-PA361210ZA01ENV RRID: AB_3678627 , 1:10,000.

Techniques: Transduction, Virus, Sequencing, Ligation, Isolation, Bacteria, Software